Review



pbabe puro gfp lamin a plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pbabe puro gfp lamin a plasmid
    Pbabe Puro Gfp Lamin A Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-wt-lamin+A+(Plasmid+%2317662)/pmc12863304-204-12-16
    Average 93 stars, based on 61 article reviews
    pbabe puro gfp lamin a plasmid - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Genome-wide CRISPR screens in spheroid culture reveal that the tumor suppressor LKB1 inhibits growth via the PIKFYVE lipid kinase
    Article Snippet: The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the TKOv3 CRISPR library (Addgene 125517, a gift from Jason Moffat). .. These alleles were then cloned into pBABE-GFP (Addgene 10668, a gift from William Hahn, Broad Institute) or pBABE-Hygro (Addgene 1765, a gift from Hartmut Land, University of Rochester) by first linearizing these backbones with EcoRI and then performing a Gibson assembly with NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). .. To generate the plasmid coding for PIKFYVE-N1939K, cDNA fragments for PIKFYVE-N1939K were synthesized by Twist Biosciences.

    Article Title: Genome-wide CRISPR screens in spheroid culture reveal that the tumor suppressor LKB1 inhibits growth via the PIKFYVE lipid kinase.
    Article Snippet: The alleles also contain mutations that confer resistance to CRISPR/ Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the TKOv3 CRISPR library (Addgene 125517, a gift from Jason Moffat). .. These alleles were then cloned into pBABE- GFP (Addgene 10668, a gift from William Hahn, Broad Institute) or pBABE- Hygro (Addgene 1765, a gift from Hartmut Land, University of Rochester) by first linearizing these backbones with EcoRI and then performing a Gibson assembly with NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). .. To generate the plasmid coding for PIKFYVE- N1939K, cDNA fragments for PIKFYVE- N1939K were synthesized by Twist Biosciences.

    Construct:

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation.
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAVGFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donorDNAconsisting ofmutated STOP codon andPAMsite, withMYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′- GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGC TTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGT GCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTC CCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCC ACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAV-GFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donor DNA consisting of mutated STOP codon and PAM site, with MYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′-GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGTGCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTCCCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCCACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Transfection:

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation.
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAVGFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donorDNAconsisting ofmutated STOP codon andPAMsite, withMYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′- GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGC TTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGT GCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTC CCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCC ACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAV-GFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donor DNA consisting of mutated STOP codon and PAM site, with MYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′-GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGTGCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTCCCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCCACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Plasmid Preparation:

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation.
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAVGFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donorDNAconsisting ofmutated STOP codon andPAMsite, withMYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′- GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGC TTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGT GCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTC CCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCC ACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Article Title: CDK9 interacts with a RanGTP-NEMP1-Importin β complex to regulate erythroid enucleation
    Article Snippet: .. Antibodies, inhibitors and other reagents are listed in supplemental Table 1. pBABE-Flag-Cdk9-IRES-eGFP, pBABE-Flag-Cdk9-T186A-IRES-eGFP and pBABE-Flag-Cdk9-D167N-IRES-eGFP were gifts from Andrew Rice (Addgene plasmid #28096, RRID: Addgene_28096; Addgene plasmid #28097, RRID: Addgene_28097; Addgene plasmid #28098, RRID: Addgene_28098). pBABE GFP was a gift from William Hahn (Addgene plasmid #10668, RRID: Addgene_10668). ..

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAV-GFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donor DNA consisting of mutated STOP codon and PAM site, with MYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′-GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGTGCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTCCCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCCACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Article Title: PP2A B55α inhibits epithelial-mesenchymal transition via regulation of Slug expression in non-small cell lung cancer.
    Article Snippet: All cell lines were tested to be mycoplasma-free using the LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma Aldrich). .. All shRNAs targeting PPP2R2A were purchased from Sigma-Aldrich. shPPP2R2A-1, TRCN0000002490; shPPP2R2A-2, TRCN0000002491; shPPP2R2A-5, TRCN0000002493. pMIG FLAG-PPP2R2A was obtained from Addgene (Plasmid #3804), and pBabe GFP-PPP2R2A was generated by PCR amplification of full-length PPP2R2A from pMIG FLAGPPP2R2A and its subsequent subcloning into pBabe GFP (Addgene, Plasmid #10668)). .. GSK3β and GSK3β (S9A) were amplified from GSK3β (1015) (Addgene, Plasmid #49491) and GSK3β S9A (1016) (Addgene, Plasmid #49492) and subcloned into pBabe puro for retrovirus production.

    Article Title: PCSK5 M452I is a recessive hypomorph exclusive to MCF10DCIS.com cells
    Article Snippet: Cells were confirmed negative for mycoplasma (R&D Systems, CUL001B) in May 2023 and were used within one month of thawing for all experiments. .. GDF11 secretion assay—pLX302 GDF11-V5 puro (RRID:Addgene_83097), pLX304 (wildtype) PCSK5-V5 blast (RRID:Addgene_83100), and pLX304 PCSK5 (T288P)-V5 blast (RRID:Addgene_83101) were described previously ( 28 ). pBabe GFP (RRID:Addgene_10668), pBabe puro HA PIK3CA H1047R (RRID:Addgene_12524), pHAGE GFP (RRID:Addgene_106281), and pHAGE PIK3CA H1047R (RRID:Addgene_116500) were commercially obtained. pDONR223 PCSK5 (M452I) (RRID:Addgene_232445) was prepared by QuikChange II XL site-directed mutagenesis (Agilent, 200521) of pDONR223 (wildtype) PCSK5 from the human ORFeome v5.1 and recombined into pLX304 (RRID:Addgene_25890) with LR clonase II (Invitrogen, 11791020) to yield pLX304 PCSK5 (M452I)-V5 blast (RRID:Addgene_232446). pDONR223 BMP2 and pDONR223 BMP4 from the human ORFeome v5.1 were similarly recombined into pLX302 (RRID:Addgene_25896) with LR clonase II (Invitrogen, 11791020) to yield pLX302 BMP2-V5 puro (RRID:Addgene_246525) and pLX302 BMP4-V5 puro (RRID:Addgene_246526). pcDNA3 was used as a carrier plasmid for lipofections, and pLX302 EGFP-V5 puro (RRID:Addgene_141348) or pLX304 EGFP-V5 blast (RRID:Addgene_232447) was used when diluting GDF11 or PCSK5 plasmid dosage and for negative controls. pcDNA3.1 HRAS (G12V) was kindly provided by David Kashatus. .. Knockout and addback of PCSK5 alleles—For PCSK5 knockout, an sgRNA sequence (sg09, CTACACGGGAAAGAACATTG) was cloned into EDCPV (RRID:Addgene_90085) by conventional restriction digest, oligo annealing, and ligation to yield EDCPV PCSK5_sg09 (RRID:Addgene_232455).

    Expressing:

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation.
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAVGFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donorDNAconsisting ofmutated STOP codon andPAMsite, withMYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′- GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGC TTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGT GCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTC CCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCC ACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Article Title: The V-ATPase complex component RNAseK is required for lysosomal hydrolase delivery and autophagosome degradation
    Article Snippet: For in vivo interscapular brown adipose tissue (iBAT) targeting, pAAV-GFP (Cell Biolabs; #AAV-400) was used as a transduction control. .. For endogenous tagging of Rnasek at the C-terminal end with a MYC tag (RNAseK-MYC) in MEF cells, the following constructs were transfected into cells: pcDNA3.3-hCas9 (a gift from George Church, Addgene plasmid #41815), pBabe-GFP (a gift from William Hahn, Addgene plasmid # 10668), a lentiGuide-Puro construct expressing sgRNA targeting RNAseK (5′‐ATACATGGTGCGCTAGAGCG-3′), and a donor DNA consisting of mutated STOP codon and PAM site, with MYC tag flanked by ~85 bp homology arms synthesised by Eurofins (5′-GCTACAACTGTTTCATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGGAATACATGGTGCGCgaacaaaaacttatttctgaagaagatctgTAGAGCGCGCTCCGCCTCTCCCTCCCCAGCCCCCTTCTCTATTTAAAGACTCCGCAGACTCCGTCCCACTCATCTGGCGTCCTTTGGGACTT-3′). ..

    Generated:

    Article Title: PP2A B55α inhibits epithelial-mesenchymal transition via regulation of Slug expression in non-small cell lung cancer.
    Article Snippet: All cell lines were tested to be mycoplasma-free using the LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma Aldrich). .. All shRNAs targeting PPP2R2A were purchased from Sigma-Aldrich. shPPP2R2A-1, TRCN0000002490; shPPP2R2A-2, TRCN0000002491; shPPP2R2A-5, TRCN0000002493. pMIG FLAG-PPP2R2A was obtained from Addgene (Plasmid #3804), and pBabe GFP-PPP2R2A was generated by PCR amplification of full-length PPP2R2A from pMIG FLAGPPP2R2A and its subsequent subcloning into pBabe GFP (Addgene, Plasmid #10668)). .. GSK3β and GSK3β (S9A) were amplified from GSK3β (1015) (Addgene, Plasmid #49491) and GSK3β S9A (1016) (Addgene, Plasmid #49492) and subcloned into pBabe puro for retrovirus production.

    Polymerase Chain Reaction:

    Article Title: PP2A B55α inhibits epithelial-mesenchymal transition via regulation of Slug expression in non-small cell lung cancer.
    Article Snippet: All cell lines were tested to be mycoplasma-free using the LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma Aldrich). .. All shRNAs targeting PPP2R2A were purchased from Sigma-Aldrich. shPPP2R2A-1, TRCN0000002490; shPPP2R2A-2, TRCN0000002491; shPPP2R2A-5, TRCN0000002493. pMIG FLAG-PPP2R2A was obtained from Addgene (Plasmid #3804), and pBabe GFP-PPP2R2A was generated by PCR amplification of full-length PPP2R2A from pMIG FLAGPPP2R2A and its subsequent subcloning into pBabe GFP (Addgene, Plasmid #10668)). .. GSK3β and GSK3β (S9A) were amplified from GSK3β (1015) (Addgene, Plasmid #49491) and GSK3β S9A (1016) (Addgene, Plasmid #49492) and subcloned into pBabe puro for retrovirus production.

    Amplification:

    Article Title: PP2A B55α inhibits epithelial-mesenchymal transition via regulation of Slug expression in non-small cell lung cancer.
    Article Snippet: All cell lines were tested to be mycoplasma-free using the LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma Aldrich). .. All shRNAs targeting PPP2R2A were purchased from Sigma-Aldrich. shPPP2R2A-1, TRCN0000002490; shPPP2R2A-2, TRCN0000002491; shPPP2R2A-5, TRCN0000002493. pMIG FLAG-PPP2R2A was obtained from Addgene (Plasmid #3804), and pBabe GFP-PPP2R2A was generated by PCR amplification of full-length PPP2R2A from pMIG FLAGPPP2R2A and its subsequent subcloning into pBabe GFP (Addgene, Plasmid #10668)). .. GSK3β and GSK3β (S9A) were amplified from GSK3β (1015) (Addgene, Plasmid #49491) and GSK3β S9A (1016) (Addgene, Plasmid #49492) and subcloned into pBabe puro for retrovirus production.

    Subcloning:

    Article Title: PP2A B55α inhibits epithelial-mesenchymal transition via regulation of Slug expression in non-small cell lung cancer.
    Article Snippet: All cell lines were tested to be mycoplasma-free using the LookOut Mycoplasma PCR Detection Kit (MP0035, Sigma Aldrich). .. All shRNAs targeting PPP2R2A were purchased from Sigma-Aldrich. shPPP2R2A-1, TRCN0000002490; shPPP2R2A-2, TRCN0000002491; shPPP2R2A-5, TRCN0000002493. pMIG FLAG-PPP2R2A was obtained from Addgene (Plasmid #3804), and pBabe GFP-PPP2R2A was generated by PCR amplification of full-length PPP2R2A from pMIG FLAGPPP2R2A and its subsequent subcloning into pBabe GFP (Addgene, Plasmid #10668)). .. GSK3β and GSK3β (S9A) were amplified from GSK3β (1015) (Addgene, Plasmid #49491) and GSK3β S9A (1016) (Addgene, Plasmid #49492) and subcloned into pBabe puro for retrovirus production.

    Mutagenesis:

    Article Title: PCSK5 M452I is a recessive hypomorph exclusive to MCF10DCIS.com cells
    Article Snippet: Cells were confirmed negative for mycoplasma (R&D Systems, CUL001B) in May 2023 and were used within one month of thawing for all experiments. .. GDF11 secretion assay—pLX302 GDF11-V5 puro (RRID:Addgene_83097), pLX304 (wildtype) PCSK5-V5 blast (RRID:Addgene_83100), and pLX304 PCSK5 (T288P)-V5 blast (RRID:Addgene_83101) were described previously ( 28 ). pBabe GFP (RRID:Addgene_10668), pBabe puro HA PIK3CA H1047R (RRID:Addgene_12524), pHAGE GFP (RRID:Addgene_106281), and pHAGE PIK3CA H1047R (RRID:Addgene_116500) were commercially obtained. pDONR223 PCSK5 (M452I) (RRID:Addgene_232445) was prepared by QuikChange II XL site-directed mutagenesis (Agilent, 200521) of pDONR223 (wildtype) PCSK5 from the human ORFeome v5.1 and recombined into pLX304 (RRID:Addgene_25890) with LR clonase II (Invitrogen, 11791020) to yield pLX304 PCSK5 (M452I)-V5 blast (RRID:Addgene_232446). pDONR223 BMP2 and pDONR223 BMP4 from the human ORFeome v5.1 were similarly recombined into pLX302 (RRID:Addgene_25896) with LR clonase II (Invitrogen, 11791020) to yield pLX302 BMP2-V5 puro (RRID:Addgene_246525) and pLX302 BMP4-V5 puro (RRID:Addgene_246526). pcDNA3 was used as a carrier plasmid for lipofections, and pLX302 EGFP-V5 puro (RRID:Addgene_141348) or pLX304 EGFP-V5 blast (RRID:Addgene_232447) was used when diluting GDF11 or PCSK5 plasmid dosage and for negative controls. pcDNA3.1 HRAS (G12V) was kindly provided by David Kashatus. .. Knockout and addback of PCSK5 alleles—For PCSK5 knockout, an sgRNA sequence (sg09, CTACACGGGAAAGAACATTG) was cloned into EDCPV (RRID:Addgene_90085) by conventional restriction digest, oligo annealing, and ligation to yield EDCPV PCSK5_sg09 (RRID:Addgene_232455).



    Similar Products

    93
    Addgene inc pbabe puro gfp lamin a plasmid
    Pbabe Puro Gfp Lamin A Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-wt-lamin+A+(Plasmid+%2317662)/pmc12863304-204-12-16
    Average 93 stars, based on 1 article reviews
    pbabe puro gfp lamin a plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc pbabe hygro mcherry gfp fis
    Pbabe Hygro Mcherry Gfp Fis, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/sg2%2E02+MUC4%2E1+(Plasmid+%23101152)/pmc12925567-251-31-30
    Average 90 stars, based on 1 article reviews
    pbabe hygro mcherry gfp fis - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc pbabe puro gfp wt lamin a plasmid
    Pbabe Puro Gfp Wt Lamin A Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-wt-lamin+A+(Plasmid+%2317662)/bio_rxiv__64898__2026__01__28__701973-227-11-16
    Average 93 stars, based on 1 article reviews
    pbabe puro gfp wt lamin a plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc progerin
    Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or <t>without</t> <t>retroviral</t> <t>progerin</t> expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).
    Progerin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-progerin+(Plasmid+%2317663)/bio_rxiv__64898__2025__12__31__697195-212-6-11
    Average 93 stars, based on 1 article reviews
    progerin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc tom misteli
    Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or <t>without</t> <t>retroviral</t> <t>progerin</t> expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).
    Tom Misteli, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-wt-lamin+A+(Plasmid+%2317662)/pm41367359-205-24-26
    Average 93 stars, based on 1 article reviews
    tom misteli - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbabe puro gfp progerin
    Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or <t>without</t> <t>retroviral</t> <t>progerin</t> expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).
    Pbabe Puro Gfp Progerin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-progerin+(Plasmid+%2317663)/pmc12554022-292-9-11
    Average 93 stars, based on 1 article reviews
    pbabe puro gfp progerin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmids pbabe puro gfp wt lamin a
    Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or <t>without</t> <t>retroviral</t> <t>progerin</t> expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).
    Plasmids Pbabe Puro Gfp Wt Lamin A, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbabe+gfp/pBABE-puro-GFP-wt-lamin+A+(Plasmid+%2317662)/pmc12554022-292-0-4
    Average 93 stars, based on 1 article reviews
    plasmids pbabe puro gfp wt lamin a - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or without retroviral progerin expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).

    Journal: bioRxiv

    Article Title: Senescence-inhibitory Δ133p53α counteracts accelerated ageing and mortality

    doi: 10.64898/2025.12.31.697195

    Figure Lengend Snippet: Tissue sections of the aorta and skin were prepared from Group-1, Group-3, and wild-type (WT) mice at 9-10 months of age (n = 5 each; open circles, females; closed circles, males). a, Restoration of vascular smooth muscle cells (VSMCs) in the aorta by Δ133p53α. Representative images of the serial sections stained with hematoxylin and eosin (H&E, top) and Verhoeff–Van Gieson (VVG, bottom) are shown (scale bars, 50 µm). The tunica media was identified by black-stained elastic fibers. Cell numbers in the tunica media (per mm 3 ) are presented as mean ± s.d. (n = 5). b, Restoration of dermal thickness in the skin by Δ133p53α. Thickness of the dermis (µm) for each mouse was calculated as the average of measurements taken at five randomly selected, approximately evenly spaced sites. Scale bars, 200 µm. Data are presented as mean ± s.d. (n = 5). Epi, epidermis; D, dermis; dWAT, dermal white adipose tissue. c, Immunofluorescence (IF) staining of Sox9 in the hair follicles. Representative images of Sox9 (green) and DAPI (blue) are shown (scale bars, 50 µm). All five mice in each group showed highly reproducible results. d, Sox9 mRNA expression analyzed by qRT-PCR in the skin of Group-1, Group-3 and wild-type mice. Data are presented as mean ± s.d. (n = 5, each with technical triplicate). e, Sox9 mRNA expression in MEFs. CAG-133 LSL/+ ; Cre Tg/+ MEFs were with or without retroviral progerin expression, and with or without 4-OHT-induced Δ133p53α expression. f, SOX9 mRNA expression in HGPS patient-derived fibroblasts. Two fibroblast strains, AG11513 and HGADFN271, were transduced with Δ133p53α-expressing (+) or control (-) lentiviral vectors. Data are presented as mean ± s.d. (n = 3, technical triplicate) ( e,f ). P values were calculated by Welch’s t -test ( a,b,d,e,f ).

    Article Snippet: The retroviral vector for expression of progerin (pBABE-puro-GFP-progerin) was obtained from Addgene (Plasmid #17663).

    Techniques: Staining, Immunofluorescence, Expressing, Quantitative RT-PCR, Retroviral, Derivative Assay, Transduction, Control